Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
Dung-Loving Deconica (Deconica coprophila)
< Back to Home

Dung-Loving Deconica

Deconica coprophila

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Strophariaceae > Deconica


Description

Deconica coprophila is a decomposer of dung that can be found in the summer. Mostly found on horse or livestock dung in Nebraska, it is a small mushroom that generally grows in large groups. It has what is known as a gelatinous pellicule, which means the top layer of the cap is jelly-like and stretchy. So much that can stretch beyond the point that the rest of the cap will break. It's almost like a "second skin" covering over the top of the cap. This feature is known to the genera Deconica and Psilocybe.

This mushroom was once included in the genus Psilocybe and was moved to its own genus due to the absence of the mind-altering substance Psilocybin and genetic differences.

The cap is brown and shiny when wet (due to the gelatinous pellicule) drying to a tanish color. Velar tissue can commonly be found on the cap margin. The stem is 'scurfy' featuring small groups (or tufts) of fibrils (hairs). The gills are horizontally attached to the stem (adnate). The spore print is blackish.


Observations

July 6th, 2023 Indian Cave State Park
Dung-loving Deconica (Deconica coprophila)

#166

Growing abundantly on horse dung on walking trail in low mixed oak/hickory woodland.

Gelatinous pellicle.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGTTGTTGCTGGCTCTCTAGGGAGCATGTGCACGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGGGATTGAGCAATCAATCGTTGGGCCTACGTTTATCATATACCCCATAGTATGTATTAGAATGTCTCAATGGGCTTCGTGCCTATAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTCTAGTTTTTACAAACTAGTAGATGGCTTGGATGTGGGGGTTTTTTGCCGGCTTTCACAAGTCAGCTCCCCTTAAATGTATTAGCCGGTGCCCTCTAACCGTCTATTGGTGTGATAATTATCGTCGCCGTAGACTATTAGACTTAGTGGCATTGCTTCTAACCGTCCTCTATGGACAATCTATGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject
July 24th, 2023 Indian Cave State Park
Dung-loving Deconica (Deconica coprophila)

235

  • Growing gregariously and in clusters on and around old horse dung along horse trail in woodland ridge.
  • Cap with gelatinous cuticle and scurfy margin.
  • Stipe scurfy.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGTTGTTGCTGGCTCTCTCGGGAGCATGTGCACGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGGGATTGAGCAATCAATCGTTGGGCCTACGTTTATCATATACCCCATAGTATGTATTAGAATGTCTCAATGGGCTTCGTGCCTATAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTCTAGTTTTTACAAACTAGTAGATGGCTTGGATGTGGGGGTTTTTTGCCGGCTTTCACAAGTCAGCTCCCCTTAAATGTATTAGCCGGTGCCCTCTAACCGTCTATTGGTGTGATAATTATCGTCGCCGTAGACTATTAGACTTAGTGGCATTGCTTCTAACCGTCCTCTATGGACAATCTATGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.