Dung-Loving Deconica
Deconica coprophila
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Strophariaceae > Deconica
Description
Deconica coprophila is a decomposer of dung that can be found in the summer. Mostly found on horse or livestock dung in Nebraska, it is a small mushroom that generally grows in large groups. It has what is known as a gelatinous pellicule, which means the top layer of the cap is jelly-like and stretchy. So much that can stretch beyond the point that the rest of the cap will break. It's almost like a "second skin" covering over the top of the cap. This feature is known to the genera Deconica and Psilocybe.
This mushroom was once included in the genus Psilocybe and was moved to its own genus due to the absence of the mind-altering substance Psilocybin and genetic differences.
The cap is brown and shiny when wet (due to the gelatinous pellicule) drying to a tanish color. Velar tissue can commonly be found on the cap margin. The stem is 'scurfy' featuring small groups (or tufts) of fibrils (hairs). The gills are horizontally attached to the stem (adnate). The spore print is blackish.
Observations
July 6th, 2023 Indian Cave State Park

#166
Growing abundantly on horse dung on walking trail in low mixed oak/hickory woodland.
Gelatinous pellicle.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGTTGTTGCTGGCTCTCTAGGGAGCATGTGCACGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGGGATTGAGCAATCAATCGTTGGGCCTACGTTTATCATATACCCCATAGTATGTATTAGAATGTCTCAATGGGCTTCGTGCCTATAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTCTAGTTTTTACAAACTAGTAGATGGCTTGGATGTGGGGGTTTTTTGCCGGCTTTCACAAGTCAGCTCCCCTTAAATGTATTAGCCGGTGCCCTCTAACCGTCTATTGGTGTGATAATTATCGTCGCCGTAGACTATTAGACTTAGTGGCATTGCTTCTAACCGTCCTCTATGGACAATCTATGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
July 24th, 2023 Indian Cave State Park

235
- Growing gregariously and in clusters on and around old horse dung along horse trail in woodland ridge.
- Cap with gelatinous cuticle and scurfy margin.
- Stipe scurfy.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGTTGTTGCTGGCTCTCTCGGGAGCATGTGCACGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGGGATTGAGCAATCAATCGTTGGGCCTACGTTTATCATATACCCCATAGTATGTATTAGAATGTCTCAATGGGCTTCGTGCCTATAAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTCTAGTTTTTACAAACTAGTAGATGGCTTGGATGTGGGGGTTTTTTGCCGGCTTTCACAAGTCAGCTCCCCTTAAATGTATTAGCCGGTGCCCTCTAACCGTCTATTGGTGTGATAATTATCGTCGCCGTAGACTATTAGACTTAGTGGCATTGCTTCTAACCGTCCTCTATGGACAATCTATGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
Created December 15, 2025 at 10:41 AM





