undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
undefined (Daldinia childiae)
< Back to Home

Daldinia childiae

Life > Fungi > Ascomycota > Pezizomycotina > Sordariomycetes > Xylariomycetidae > Xylariales > Hypoxylaceae > Daldinia


Description

Daldinia childiae is a decomposer of wood and is common in Nebraska. The fruiting times are spring through fall, though the tough fruiting bodies will overwinter and can be found year-round. Though mostly found on broadleaf trees it is sometimes found on conifers.

The fruiting body is mostly ball-shaped with an outer surface that is black or brown. When broke in half, the contents feature charcoal-like concentric zones of black and gray. When these contents are mixed with dilute KOH the resulting color is brownish which distinguishes it from the European Daldinia concentrica which produces purple with the same test.


Observations

July 26th, 2023 Indian Cave State Park
 (Daldinia childiae)

#252

  • Growing scattered on fallen American Hophornbeam tree on open West-facing mixed oak/hickory woodland slope above creek.
  • Exterior purple matte color.
  • Interior charcoal-like with concentric zones of growth.
  • Additional Info
  • Smell: not distinctive
  • Taste: not distinctive
  • KOH yellowish orange when mixed with interior surfaces and black on outer surface.
DNA Barcode ITS:
GAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTTCAACCCTTAAGCCTAAGTTGCTTAGCGTTGGGAATCTGCCCTGTATTACGGGGCAGTTCCCTAAAGTTATCGGCGGAGTTAGGGCATACTCTAAGCGTAGTACTATTATTCTCGCTTCTGCAGTTGTCCCGACGGCTTGCCGCTAAACCCCTATATTTTCTAGTGGTTGACCTCGGATTAGGTAGGAATACCCGCTGAACTTAA

Observation by thefungiproject
September 12th, 2024 Neale Woods
Daldinia Childiae Group (Daldinia childiae)

Not Collected.


Observation by thefungiproject
September 12th, 2024 Neale Woods
Daldinia Childiae Group (Daldinia childiae)

Not Collected.


Observation by thefungiproject
September 12th, 2024 Neale Woods
Daldinia Childiae Group (Daldinia childiae)

Not Collected.


Observation by thefungiproject

References

Kuo, M. (2019, October). Daldinia childiae. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/daldinia_childiae.html


Created December 15, 2025 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.