Discrete Birds Nest Fungus
Crucibulum parvulum
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Crucibulum
Description
This bizarre decomposer is composed of a nest-like structure containing disc-like eggs, which are small spore sacks. This fungus has an interesting method of spore dispersal. The nest is structured so that it may catch falling raindrops which splash the eggs to other locations to seed future mycelium.
Crucibulum parvulum can be found growing on twigs, woodchips, and roots east of the Rocky Mountains from summer through fall.
The Discrete Birds Nest is considered a smaller version of the Common Birds Nest (Crucibulum laeve). The former is described with a nest 1.5-3mm wide and the latter 4-10mm wide. Interestingly enough, this specimen seems to be bigger than described, but the DNA results matched Crucibulum parvulum... It seems that DNA testing might be necessary to accurately separate the two species.
Observations
July 26th, 2023 Indian Cave State Park

#253
- Growing locally abundant on downed hardwood twig on Southwest- facing slope above creek in mixed oak/hickory woodland.
- Young specimens with a subtomentose veil covering peridium.
- Peridium white with tannish peridioles not attached by finiculus.
- Basal surfaces subtomentose similar to veil tissues.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATAAACCTGGTTTGCTGTTGCTGGCTCTTCGGAGTATGTGCACGCTTATCATCTTTATATTTCCACCTGTGCACCTTTTGTAGACTTGGATTATCTCTCGAGGCAACTCGGATGTTGGGTTTGCAGTTGTGAAAACTCTGCTCTCCTTGTATTATCCAGTCTATGTTAATTATATACACCATTAGTATGTTTATAGAATGTCGTTATTAGGATTTCAAATCCTTTTAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCACTTCTTCTTTTATTAGTTGAAGCTGGCTTGGATGTGGGGGTTGCGGGCTTTTCTAATAAAAAGGTCGGCTCCTCCTTAAATGCATTAGCAGAACCTTATGTGGGATCAGCTATTGGTGTGATAATTATCTACGCCATTGGTTGTGAAGCAGCTATATACGGGGTTCAGCTTCTAATCGTCTGCAAGGACAATTATATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Crucibulum parvulum H.J. Brodie, Canadian Journal of Botany 48 (5): 848 (1970) [MB#312321]
Kuo, M. (2014, February). Crucibulum laeve. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/crucibulum_laeve.html
Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM