Discrete Birds Nest Fungus (Crucibulum parvulum)
Discrete Birds Nest Fungus (Crucibulum parvulum)
Discrete Birds Nest Fungus (Crucibulum parvulum)
Discrete Birds Nest Fungus (Crucibulum parvulum)
Discrete Birds Nest Fungus (Crucibulum parvulum)
Discrete Birds Nest Fungus (Crucibulum parvulum)
< Back to Home

Discrete Birds Nest Fungus

Crucibulum parvulum

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Crucibulum


Description

This bizarre decomposer is composed of a nest-like structure containing disc-like eggs, which are small spore sacks. This fungus has an interesting method of spore dispersal. The nest is structured so that it may catch falling raindrops which splash the eggs to other locations to seed future mycelium.

Crucibulum parvulum can be found growing on twigs, woodchips, and roots east of the Rocky Mountains from summer through fall.

The Discrete Birds Nest is considered a smaller version of the Common Birds Nest (Crucibulum laeve). The former is described with a nest 1.5-3mm wide and the latter 4-10mm wide. Interestingly enough, this specimen seems to be bigger than described, but the DNA results matched Crucibulum parvulum... It seems that DNA testing might be necessary to accurately separate the two species.


Observations

July 26th, 2023 Indian Cave State Park
 (Crucibulum parvulum)

#253

  • Growing locally abundant on downed hardwood twig on Southwest- facing slope above creek in mixed oak/hickory woodland.
  • Young specimens with a subtomentose veil covering peridium.
  • Peridium white with tannish peridioles not attached by finiculus.
  • Basal surfaces subtomentose similar to veil tissues.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATAAACCTGGTTTGCTGTTGCTGGCTCTTCGGAGTATGTGCACGCTTATCATCTTTATATTTCCACCTGTGCACCTTTTGTAGACTTGGATTATCTCTCGAGGCAACTCGGATGTTGGGTTTGCAGTTGTGAAAACTCTGCTCTCCTTGTATTATCCAGTCTATGTTAATTATATACACCATTAGTATGTTTATAGAATGTCGTTATTAGGATTTCAAATCCTTTTAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTATCAACCACTTCTTCTTTTATTAGTTGAAGCTGGCTTGGATGTGGGGGTTGCGGGCTTTTCTAATAAAAAGGTCGGCTCCTCCTTAAATGCATTAGCAGAACCTTATGTGGGATCAGCTATTGGTGTGATAATTATCTACGCCATTGGTTGTGAAGCAGCTATATACGGGGTTCAGCTTCTAATCGTCTGCAAGGACAATTATATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Crucibulum parvulum H.J. Brodie, Canadian Journal of Botany 48 (5): 848 (1970) [MB#312321]

Kuo, M. (2014, February). Crucibulum laeve. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/crucibulum_laeve.html


Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025