Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
Saffron Oysterling (Crepidotus crocophyllus)
< Back to Home

Saffron Oysterling

Crepidotus crocophyllus

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Crepidotaceae > Crepidotus


Description

The Saffron Oysterling (Crepidotus crocophyllus) is a wood-decaying fungus (saprotroph) that grows on dead wood. It fruits from spring through fall and is widely distributed across tropical, subtropical, and temperate regions. The fruiting bodies usually grow in clusters or scattered along fallen logs, often resembling small seashells.

The scientific name crocophyllus comes from the Greek krokos (‘saffron, orange-colored’) Latinized to croc-, combined with -phyllon (‘leaf’); literally meaning “saffron leaf.” In mycology, the suffix -phyllus refers to gills, highlighting the saffron-yellow gills of young specimens (Donald J. Borror, 1988).

When young, this mushroom is strikingly bright in color. The cap surface is woolly, covered with brown or wine-colored fibrils (tiny hair-like fibers), and the margin (edge of the cap) is rolled inward. The gills start out saffron-yellow with somewhat jagged edges. As the mushroom matures, the cap surface becomes smoother and dull brown, though it often retains a bit of woolly texture near the center. The cap margin straightens with age, and the gills fade to white, tan, or brownish tones.

This species lacks a true stem, produces a brown spore print, and is considered hygrophanous (it changes color based on its hydration level). It has no distinct odor, but the taste is reported as bitter.

A simple chemical test with potassium hydroxide (KOH) can help with identification. On young caps, KOH turns the surface red, while on older caps it produces gray to black reactions. Applied to the gills, KOH creates a vivid red color.

This species is not considered edible.


Observations

May 16th, 2023 Indian Cave State Park
Saffron Crep (Crepidotus crocophyllus)

37

Growing on large fallen Hackberry log in low moist oak/hickory woodland draw.

DNA Barcode ITS:
TTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGGAATAAACCTGGTGGACTGTCGCTGGCTCTCTTGAGAGCATGTGCACGTCTGTCATCTTTATCTTTCCACCTGTGCACCTTTTGTAGACCTGGATGCTTAATATATCAATCTGAGGTCAACTCAGGCGTGAGGACTGTCGGCGTCGCAAGATATCGGCTTTCCTTGTAGCATTCCAGGGACTATGTTTTTCATACACACTTTAAAAATCTAATAGAATGTCGTTTTAAAAAGGTCTTTGTACCTATATAAAACAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGTCAGCTTTTACCGGCTGGTCAAGGCTTGGATGTGGGGGTTTTTTTTGCAGGTCTTCACAGATCTGCTCCCCTGAAATACATTAGTGGTGCCTCTGTAGTGTGAGCGGCTATTTGGTGTGATAATCTATCTACGCCATTAGACGGCCTACATCTCTTGAATGAGAAGGAGGGATTAATCTGCTTATAACCGTCCTTCGGGACAAACATAAATGACTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACGAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCT

Observation by thefungiproject
May 29th, 2025 Indian Cave State Park
Saffron Crep (Crepidotus crocophyllus)

Not collected.


Observation by thefungiproject

References

Bandala, V. M., Montoya, L., & Mata, M. (2008). Crepidotus crocophyllus found in Costa Rica and Mexico and revision of related species in subsection Fulvifibrillosi. Mycologia, 100(2), 335–346. https://doi.org/10.1080/15572536.2008.11832489

Donald J. Borror. (1988). Dictionary of Word Roots and Combining Forms Compiled from the Greek, Latin, and Other Languages. Mayfield Publishing Company. https://www.penguinprof.com/uploads/8/4/3/1/8431323/dictionary_of_word_roots_and_combining_forms.pdf

Kuo, M. (2023, June). Crepidotus crocophyllus. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/crepidotus_crocophyllus.html


Created August 3, 2026 at 6:40 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.