Tiffany's Webcap
Cortinarius tiffanyae
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Cortinariaceae > Cortinarius
Description
Cortinarius tiffanyae is a mycorrhizal mushroom that appears in mid to late summer (July–August) in hardwood forests of northeastern North America. It grows on the ground in association with trees like oak (Quercus), beech (Fagus), maple (Acer), basswood (Tilia), and elm (Ulmus) (Healy et al., 2020). This species was named in honor of Dr. Lois H. Tiffany, a pioneering mycologist from Iowa State University.
The cap starts out conical or rounded and flattens with age, often developing a small bump in the center. Its surface is dry, silky, and shiny when fresh, usually showing fine radial cracks as it matures. Colors range from dark reddish-brown to paler reddish-yellow as the cap dries. The gills are widely spaced and shift from pale purplish to reddish-brown, often with lighter edges. The stem can show a gradient of color—lavender near the top fading to cream, and ending in a yellow-orange to reddish base. A reddish-brown spore print and an unpleasant or fruity odor help set this species apart from others in the woods.
Observations
July 16th, 2023

#206
- Growing gregariously on open mixed oak/hickory woodland ridge.
- Nearby Trees: Bitternut Hickory, Black Oak, Chinkapin Oak, American Hophornbeam, Ash, and Elm.
- Cap hygrophanous, bald developing a lightly hairy (fibrous) margin. Cortina present.
- Stipe compressible (hollow or with central pith), fibrous with orange longitudinal streaks, causing an iridescent effect, swollen at base. Basal mycelium with bright reddish-orange elements.
- Additional Info
- Smell: Fruity
- Taste: Somewhat fruity (not sweet).
- KOH: Dark red on cap, bright purple on stipe.
- Ammonia: Negative on cap and bright violet on stipe.
- Microscopy: rehydrated in KOH and mounted in Melzer's+Congo Red.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGCTCTCTAGAGAGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGGCCCTTGGAATATTTTCCATGGTCTATGTTGCTTCTGCAATTACCCCCAATGTATGTTAACAGAATGTTTGTGCCTTATGAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCCTCTTCTTGTTGAGTGGGTTTGGATGTGGGGGGGTTTGCTGGCCACTTTAAGAGGTCAGCTCCTCTGAAATGCATCAGCAGAACGACCTGTTCATTGGTGTGATAACTATCTACGCTATTGAATGATGAAGGCAGTTCAGCTTTCTAACAGTCCTTGGACAACTTATCATTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
References
Healy, R. A., Ammirati, J. F., & Liimatainen, K. (2020). Cortinarius tiffanyae sp. nov. Index Fungorum, No. 456, 1. https://www.indexfungorum.org/Publications/Index%20Fungorum%20no.456.pdf
Created March 17, 2026 at 9:26 PM
















