undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
undefined (Cortinarius sp-NE01)
< Back to Home

Cortinarius sp-NE01

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Cortinariaceae > Cortinarius


Description

Cortinarius sp-NE01 is a cryptic name for a not yet described Webcap species documented from Indian Cave State Park in eastern Nebraska. It was found growing on the ground in mid to late fall, likely forming mycorrhizal associations with oaks or other nearby trees.


Observations

September 21st, 2023 Indian Cave State Park
Webcaps (Cortinarius sp-NE01)

#415

  • Growing gregariously or fused at base in mixed oak/hickory woodland draw.
  • Nearby Trees: American Hop Hornbeam, Elm, Bur Oak, Ash, American Hackberry, Shagbark Hickory, and Black Walnut.
  • Cap light brown with a tangled-fibrous like texture more evident near the inrolled margin. Cortina remnants present on younger specimens.
  • Lamellae light tan, adnate, with frequent partial gills.
  • Stipe white, fibrulose, tannish below with annular zone and with bulbous base.

Additional Details

  • Smell: not distinctive
  • Taste: not distinctive
  • Ammonia: negative
  • KOH: Brown on pileipellis
  • Spore Print: rusty brown

Observation by thefungiproject
August 16th, 2023 Indian Cave State Park
Webcaps (Cortinarius sp-NE01)

316

Growing gregariously from and near moss patches on open mixed oak/hickory woodland.

Nearby trees: American Hop Hornbeam, Shagbark Hickory, Chinkapin Oak, Eastern Red Cedar, Black Walnut, and Ash.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGACGGGTTGTTGCTGGCTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACTTTTTGTAGGCCTTTCAGGTCTATGTTGCTTCATTTTACCCCAATGTATGTTAATAGAATGTTGTGCCTATATAATATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCTTCTCCTTGTTGAGAGGTTTGGATGTGGGGGTCTTGCTGGCCTTTTTTAAAAGGTTTCAGCTCCTCTGAAATACATTAGCAGAACAAACCTGTTCATTGGTGTGATAATTATCTACGCTATTGAATGTGAGGAGCAGTTCAGCTTTCTAACGGTCCTCGGACAAATTCATCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

Created December 15, 2025 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.