Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
Slinder-Footed Cordyceps (Cordyceps tenuipes)
< Back to Home

Slinder-Footed Cordyceps

Cordyceps tenuipes

Life > Fungi > Ascomycota > Pezizomycotina > Sordariomycetes > Hypocreomycetidae > Hypocreales > Cordycipitaceae > Cordyceps


Description

The Slinder-Footed Cordyceps (Cordyceps tenuipes) is an entomopathogenic mushroom that grows on cocooned month and butterfly pupae in the order Lepidoptera. The fruiting bodies grow in damp, shady wooded areas in the summer. It can be found eastern North America and can also be found in Mexico, China, and Australia.

The host is sometimes rolled up in a leaf on the forest floor to pupate. The fungus infects the pupa, consumes its body, then grows spore-producing structures (stroma) with white powdery tips out of the leaf "burrito". These fruiting bodies offer a noticeable neon-yellow white color contrast amidst the dark leaf duff for keen-eyed mushroom hunters.


Observations

August 2nd, 2023 Indian Cave State Park
 (Cordyceps tenuipes)

#275

  • Growing from unknown insect host curled in oak leaf in low/moist riparian area, just below mixed oak/hickory woodland slope.
  • Several light tan stroma with white powdery tips that easily rub off on contact.

-2nd and 3rd specimens found among oak leaf litter roughly 10 meters away.

DNA Barcode ITS:
GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCAGAGTTTTACAACTCCCAACCCTTCTGTGAACCTACCCATAGTTGCTTCGGCGGACCCGCCCCAGCGTCCGGACGGCCCAGCGCCGGCCCGGGACCTGGACCCAGGCGGCCGCCGGGGACCACGCAACCCTGTATCTGTCAGCCTCTCTGAATCCGCCGCAAGGCAACACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCCGGGACGTCGGCCTTGGGGACCGGCAGCACCCCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTACAAGCACTCGCACCGGGAACCCGACGCGGCCCGCCGTGAAACCCCCAACCTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject
September 12th, 2024 Neale Woods
 (Cordyceps tenuipes)

Not Collected.


Observation by thefungiproject
September 24th, 2024 Indian Cave State Park
 (Cordyceps tenuipes)

Not Collected. Both growing in small lepidopteran pupa underneath well rotted log in mixed Oak woodland draw.


Observation by thefungiproject

References

Kepler, R.M., Luangsa-ard, J.J., Hywel-Jones, N.L. et al. A phylogenetically-based nomenclature for Cordycipitaceae (Hypocreales). IMA Fungus 8, 335–353 (2017). https://doi.org/10.5598/imafungus.2017.08.02.08

Lee, K. M., Hong, I. P., Nam, S. H., Sung, G. B., & Bae, Y. H. (2008). The cultural characteristics and antibacterial activities of Cordyceps militaris and Paecilomyces tenuipes. Korean journal of applied entomology, 47(4), 479-486. https://koreascience.kr/article/JAKO200805441023179.pdf

Zha, L. S., Wen, T. C., Huang, S. K., Boonmee, S., & Eungwanichayapant, P. D. (2019). Taxonomy and biology of Cordyceps qingchengensis sp. nov. and its allies. Phytotaxa, 416(1), 14-24. https://phytotaxa.mapress.com/pt/article/view/35913/30762


Created August 10, 2026 at 10:51 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.