Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
Scaly Ink Cap (Coprinopsis variegata)
< Back to Home

Scaly Ink Cap

Coprinopsis variegata

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Psathyrellaceae > Coprinopsis


Description

The Scaly Ink Cap (Coprinopsis variegata) is a decomposer that can be found in the spring and fall (occasionally in the summer). It is widely distributed and common in North America and can fruit in substantial numbers. It grows on wood and can appear like it is growing from the soil, though it is actually originating roots underground. It is widespread and common.

The mushroom originates from an egg-shaped button stage. As it grows, it splits the veil open leaving bits of split tissue on the cap surface and remnants of the veil on the stem near the base. The gill color starts whitish, becoming black at maturity.

This mushroom will digest itself through a phenomenon called deliquescence or "the process of turning into a liquid". The inky mess is loaded with spores. Flies and other insects are attracted to it and get covered in the ink, which later disperse the spores by traveling to other areas. This is an amazing example of how mushrooms hack the behaviors of other organisms to complete their lifecycles and spread to new territories.


Observations

May 16th, 2023 Indian Cave State Park
Scaly Ink Cap (Coprinopsis variegata)

31

Growing in clusters on well-decayed hardwood log in the bottom of large mixed oak/hickory woodland draw.


Observation by thefungiproject
June 18th, 2024 Niobrara Valley Preserve
Scaly Ink Cap (Coprinopsis variegata)

Not Collected


Observation by thefungiproject
June 27th, 2023 Indian Cave State Park
Scaly Ink Cap (Coprinopsis variegata)

#143

Growing abundantly down the length of rotting hardwood log in low riparian woodland area.

  • Scales easily removed.
  • KOH slightly yellowing on stipe.
DNA Barcode ITS:
GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAACTTTTGTTGTGTGAAGGCTTGGATTTGGAGGTGTGCAGGTCCACATTTTTTAGTGGTCTGCTCCTCTGAAATGTATTAGTGGGTTAGGCCCCCTAATCTATTGGTGTGATAATTATCTACACCGTGGATTTGGGAAAGCTACATTTAGACCTGCTTCTAACCGTCCTCACAGGGGACAACATTTGACAATTTTGACCTCAAATCAGGTAAGACTACCCGCTGAACTTAA
View MycoMap DNA Results
Observation by thefungiproject
June 16th, 2024 Niobrara Valley Preserve
Scaly Ink Cap (Coprinopsis variegata)

Not Collected


Observation by thefungiproject
June 17th, 2024 Niobrara Valley Preserve
Scaly Ink Cap (Coprinopsis variegata)

Not collected


Observation by thefungiproject

References

Kuo, M. (2024, June). Coprinopsis variegata. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/coprinopsis_variegata.html


Created March 25, 2025 at 4:28 PM and last updated March 25, 2025 at 4:28 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025