undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
undefined (Coprinopsis pseudonivea)
< Back to Home

Coprinopsis pseudonivea

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Psathyrellaceae > Coprinopsis


Description

Coprinopsis pseudonivea is a small mushroom that grows on cow dung or compost, most often during the summer through fall. It appears alone or in small groups and belongs to the group of the inkcaps, which dissolve into black ink as they mature. The name pseudonivea means “false snow-white,” referring to its resemblance to Coprinopsis nivea, a similar species. It is known for its variable and often strong smell, described by different collectors as yeast-like, coconut, cinnamon, or fruity.

The cap starts out narrow and oval, then expands to about 1.5 inches (4 cm) wide. It is coated in a white to gray powdery layer and often splits around the edges as it opens. The gills are not attached to the stem and change from white to black with age. The stem is long and slender, white to grayish in color, sometimes slightly swollen at the base, and covered with soft white flakes. The spore print is dark purple-black.


Observations

July 17th, 2023 Indian Cave State Park
 (Coprinopsis pseudonivea)

#216

  • Growing gregariously on horse dung in well-shaded mixed oak/hickory woodland.
  • Cap delicate, semitranslucent with an upward-rolling margin at maturity.
  • Stipe long, delicate, iridescent, with cotton-like elements closer to the base.
  • Gills very shallow and blackish closer towards the center.
  • Caps later deliquesced, leaving stipes intact.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAATCTGATGTGGTTGTAGCTGGCTCTCCGGAGTATGTGCACACCCGTCACCTTTATCTCACTCCCTGTGCACACACTGTAGGCTTGGATACCTCTCGCCGAATAGGCGGATGCAGAGATTGCTGGTCCTTCACTGGTCAGCTCTCTTTGAATTTCCAAGTCTATGATTTTACATACCCCAAACGAATGTTACAGAATGTATTTGTATGGCCTTGTGCCTATAAATCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCCACCAGTTTGCGAAAACCGGTGAAGCTTGGATGTGGAGGTTTTGCAGGTCCGTCACCGGTCTGCTCCTCTGAAATGTATTAGCAGGTTAAGCTACCTGTCTATTGGTGTGATAATTATCTACATCGTGGACTAGGATCAGCAATAAATTGACCAGCTTCTAATCGTCCGCAAGGACAATTACTTGACAAACTTGACCTCAAATCAGGTAAGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Redhead, S.A.; Vilgalys, R.; Moncalvo, J.-M.; Johnson, J.; Hopple, J.S. Jr. 2001. Coprinus Persoon and the disposition of Coprinus species sensu lato. Taxon. 50(1):203-241

Uljé, C.B.; Noordeloos, M.E. 1993. Studies in Coprinus - III. Coprinus section Veliformes. Persoonia. 15(3):257-301


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.