undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
undefined (Clavulina sp-IN06)
< Back to Home

Clavulina sp-IN06

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Cantharellales > Hydnaceae > Clavulina


Description

Observed in the summer at Indian Cave State Park in eastern Nebraska, this small, white fungus had a coral/club-like form with minimal branching compared to other Clavulina species in the area. It was growing on the ground in a mixed hardwood forest, appearing to be mycorrhizal. The shape and stature were reminiscent of Clavulina rugosa. This collection is currently being referred to under the provisional name Clavulina “sp-IN06” while it awaits formal study and description.


Observations

July 26th, 2023 Indian Cave State Park
Antler And Spindle Fungi (Clavulina sp-IN06)

#249

  • Growing gregariously terrestrially on Southwest-facing oak/hickory slope above creek.
  • white, some flattened and branching, with pointed tops.
  • slgihtly flexible
DNA Barcode ITS:
GAACGCAACTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGTGAAATTTCTCAAGCTTGGATGGATTTTTCTGTCCTTAGTTTGGTTGTTGGGCTTTGCCGTGTCCTTCATCGGAACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGTTGAGGACATCTTTTGGGATGGCCGGTCTTCATTTGGGTTGCTTCTAAACCTGGTTTTTGCAGATTGTTTCAATCTGTATTCCACTTTTCAGCTTTGACCTCGAATCAGGTGGGACTACCCGCTGAACTTAA
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2007, April). *Clavulina rugosa*. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/clavulina_rugosa.html


Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025