undefined (Clavulina sp-IN05)
undefined (Clavulina sp-IN05)
undefined (Clavulina sp-IN05)
undefined (Clavulina sp-IN05)
undefined (Clavulina sp-IN05)
undefined (Clavulina sp-IN05)
< Back to Home

Clavulina sp-IN05

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Cantharellales > Hydnaceae > Clavulina


Description

Observed in the summer at Indian Cave State Park in eastern Nebraska, this small, white, coral-like fungus was growing gregariously among moss on the forest floor. Its branching form was compact but distinct, with multiple fruiting bodies locally abundant. It appeared to be mycorrhizal, associating with nearby hardwoods. This collection was originally documented in southern Indiana and is currently being referred to under the provisional name Clavulina “sp-IN05” while it awaits formal study and description.


Observations

July 11th, 2023 Indian Cave State Park
 (Clavulina sp-IN05)

#191

  • Growing scattered terrestrially among moss along trail on northeast-facing slope in open mixed oak/hickory woodland, near edge.

Smell: pleasant and sweet. Taste: not distinctive. KOH: turning surfaces tannish-brown.

  • Returned later and added more pictures and gathered more specimens. (7/25)
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGTTGTGATGGGGTTTGATGCTGGCAGCCAATTTTTGGATGCATGTGCTCGCCCTAACAATCATCTTCCAAACACCTGTGCACATTTTTGAGGGAGTTTTGAGTTTATCCGCTTTATGGTGATTTTCTTGTGATTCCCTTAAATCATTATACGCTGTTAACCAATGATGAACGTGCTTTGTGCCGTAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGTGAAATTTCTCAAGCTTTGGATGGCTTTGTTGTCTGTCCTTGGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGTGGCACTGGTTCTACTCAGCGTGATAATAGTCTGATCGCTGAGGACATCTTTTAGGATGGCCAGTTCTCATTTGGGTTGCTTCCAACTTGGTTTTGCAGATTCTTCAATCTGTGTTCCACTTTTCAGCTTTGACCTCGAATCAGGTGGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2007, April). Clavulina cristata. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/clavulina_cristata.html

Kuo, M. (2007, April). Clavulina rugosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/clavulina_rugosa.html


Created May 19, 2025 at 9:31 PM and last updated May 19, 2025 at 9:31 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025