undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
undefined (Clavulina sp-IN01)
< Back to Home

Clavulina sp-IN01

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Cantharellales > Hydnaceae > Clavulina


Description

This white, coral-like fungus was found in the summer at Indian Cave State Park in eastern Nebraska and was originally documented in southern Indiana. It is mycorrhizal and grows on the ground, forming upright, branched structures similar to antlers or coral. It closely resembles Clavulina cristata or Clavulina coralloides (Kuo, 2007). This is a provisional species name, used temporarily while it awaits formal description and a long-term placement.


Observations

July 23rd, 2023 Indian Cave State Park
 (Clavulina sp-IN01)

#222

  • Growing gregariously form soil near mixed oak/hickory woodland edge.
  • Near Trees: Black Oak, Shagbark Hickory, Northern Red Oak, Bur Oak, and Eastern Red Cedar.
  • Upper portions of fruiting body brittle, grayish-purple hue, turning brown towards the tips and white below.
  • Some with more pronounced stipe.

Smell: earthy Taste: not distinctive. KOH: negative. Ammonia: negative

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGTTGTAACGGGGTTTGATGCTGGCAGACCAATTTTATTTTGGGATGCATGTGCTTGCCCCAACAATCATTTTCCAAACACCCGTGCACATTTTTGAGGGAGTTTCGAGTTGATTGCCTCTTTTGGGGTGATTTTCCTGTATCCCCTCAAATTTCATTATACGCTATTAACAATGCCGAACGTGCTTTGTGCCGCAAGGCCTTAAACATTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGCGTCGCGAAATTCCTCAAGCTTTTGGATGGCCCTTTTTGCGTCTGTCCTTGGGCTTGGTTGTTGGGCTCTGCCGTGTCCTTCATTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTTGTGTGGTACTGGTTCTACTCAGCGTGATAACAGTCTGATCGTTGAGGACATCCTTTGGATGGCCAGTCCTCATTTGGGTTGCTTCTAAACCGGTTTCGCAGATTGCCCAATCTGCTTACCACTTTTCAGCTTTGACCTCGAATCAGGTGGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Kuo, M. (2007, April). Clavulina cristata. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/clavulina_cristata.html

Kuo, M. (2007, April). Clavulina rugosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/clavulina_rugosa.html


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.