The Prismatic Wavy Cup (Chlorencoelia torta) is a decomposer of wood that can be found from July to mid-October growing on a wide variety of tree species. Generally found on well-decayed, barkless logs in central to north-eastern North America. The featured specimen was found on presumed American Linden.

The Prismatic Wavy Cup features a wide variety of unusual color transitions, from blue, to yellow, to olive-green, brown, and even orange. It can be found growing solidarity, in groups, and sometimes multiple cups growing from the same stem (caespitose). Fruiting bodies grow as a cup when young, later transitioning into a flattened disc with a wavy margin. This feature is how it gets its species name torta, meaning twisted or contorted (Dixon, 1975).

August 8th, 2023 Field Notes - Indian Cave State Park:

Growing on downed well decayed hardwood log (possibly American Linden) in low, moist, and shady woodland draw.

• Fruiting bodies cup-like when young, flattening with a wavy margin when mature.
• Hymenium brown with greenish tints.
• Pseudostem dark brownish res on the bottom side.
• Flesh firm.
• Smell: not distinctive.
• Taste: not distinctive.
• KOH: black (or very dark) on both fertile and sterile surfaces.
• Spore Print: white

DNA Barcode ITS: GAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGCTCGAGCGTCATTTCAACCCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCTGGCAACGGCAGGCCTTAAAGACAGTGGCGGTGCCCTGAGGCCCTGAGCGTAGTACATCTCTCGCTACAGGTTCCTGAGGGTTCACTGGCCAGCAACCCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA