Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
Prismatic Wavy Cup (Chlorencoelia torta)
< Back to Home

Prismatic Wavy Cup

Chlorencoelia torta

Life > Fungi > Ascomycota > Pezizomycotina > Leotiomycetes > Leotiomycetidae > Helotiales > Cenangiaceae > Chlorencoelia


Description

The Prismatic Wavy Cup (Chlorencoelia torta) is a decomposer of wood that can be found from July to mid-October growing on a wide variety of tree species. Generally found on well-decayed, barkless logs in central to north-eastern North America. The featured specimen was found on presumed American Linden.

The Prismatic Wavy Cup features a wide variety of unusual color transitions, from blue, to yellow, to olive-green, brown, and even orange. It can be found growing solidarity, in groups, and sometimes multiple cups growing from the same stem (caespitose). Fruiting bodies grow as a cup when young, later transitioning into a flattened disc with a wavy margin. This feature is how it gets its species name torta, meaning twisted or contorted (Dixon, 1975).


Observations

August 8th, 2023 Indian Cave State Park
 (Chlorencoelia torta)

#286

Growing on downed well decayed hardwood log (possibly American Linden) in low, moist, and shady woodland draw.

  • Fruiting bodies cup-like when young, flattening with a wavy margin when mature.
  • Hymenium brown with greenish tints.
  • Pseudostem dark brownish res on the bottom side.
  • Flesh firm.
  • Smell: not distinctive.
  • Taste: not distinctive.
  • KOH: black (or very dark) on both fertile and sterile surfaces.
  • Spore Print: white
DNA Barcode ITS:
GAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGCTCGAGCGTCATTTCAACCCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCTGGCAACGGCAGGCCTTAAAGACAGTGGCGGTGCCCTGAGGCCCTGAGCGTAGTACATCTCTCGCTACAGGTTCCTGAGGGTTCACTGGCCAGCAACCCCAAATTTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Observation by thefungiproject

References

Dixon, J.R. 1975. Chlorosplenium and its segregates. II. The genera Chlorociboria and Chlorencoelia. Mycotaxon. 1(3):193-237. Retrieved January 27th, 2025 from: https://www.mykoweb.com/systematics/journals/Mycotaxon/Mycotaxon%20v001n3.pdf

Kuo, M. (2015, May). Chlorencoelia torta. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/chlorencoelia_torta.html


Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025