Chicago Chanterelle
Cantharellus chicagoensis
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Cantharellales > Hydnaceae > Cantharellus
Description
The Chicago Chanterelle (Cantharellus chicagoensis) is a mycorrhizal mushroom that can be found in Oak-dominated forests (though possibly associating with other broadleaf trees). It can be found across north central North America from July - September. This mushroom was once grouped into a different species called the Golden Chanterelle (Cantharellus cibarius) until DNA testing distinguished it to be a separate species (Leacock, et al., 2016).
The cap, fertile surface (hymenium), and stem are all yellow, though often greenish-yellow hues can be present when immature. This mushroom is not composed of true gills. Instead, the spore producing surface is constructed by wavy, forking ridges that run down the stem (decurrent). These ridges aren't easily separable from the mushroom which would be more typical of true "gills".
The Chicago Chanterelle grows from the soil and associates with Oak and other hardwoods. The featured specimen was found growing amidst a population of Chinkapin Oak, Elm, Northern Red Oak, Black Walnut, and Bur Oak. The smell and taste are faint to unnoticeable.
July 6th, 2023 Field Notes - Indian Cave State Park:
Growing gregariously (some fused) in mixed oak/hickory woodland.
Associated trees: Chinkapin oak, Elm, Northern Red Oak, Black Walnut, and Bur Oak.
- Smell: faintly floral
- Taste: not distinctive.
DNA Barcode ITS: GAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCGGAGGATGAAGACAAGGGTATCTCTGGCTGAGGGTAATGTAAACTGATCCGGTCGTACCACTGGTTGACTGGGGATTGGGCTCGCTTGGAGCGATATCGCTCTGGCTTGCCTTAAAATCAAGCGTTGTGTGGATTGGACTTTCAAGCGTGCATTGGGGACGCAGGCTCTGCGCTATATGGCAAGCCCTTGACCGTCATAGGTGCTTTGATTGGGGTCTTCAGTCTAGCCAACAAGGCTGGGTTGGACTTTGGGGCTGCATTGGGGGCGTAGGGCAGCTCTGTTCGTGGCGTCCGATGACCGTCATGGTGCATGATTGGACTTCAACTAGCAATTATTATCATTATCATTACTATGGGTTTACCTCAGGTCAGAGAAGACTACCCGCTGGACTTAA
References
Kuo, M. (2015, March). Cantharellus "cibarius." Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/cantharellus_cibarius.html
Leacock, P. R., Riddell, J., Wilson, A. W., Zhang, R., Ning, C., & Mueller, G. M. (2016). Cantharellus chicagoensis sp. nov. is supported by molecular and morphological analysis as a new yellow chanterelle in midwestern United States. Mycologia, 108(4), 765–772. https://doi.org/10.3852/15-230
Created March 17, 2026 at 9:26 PM


