Hesler's Lute
Callistosporium hesleri
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Callistosporiaceae > Callistosporium
Description
Hesler's Lute (Callistosporium hesleri) is an exceptionally rare mushroom. It was first collected and described in 1983, and wasn't found again until a soil DNA study found the mycelium in a Pine plantation in South Carolina in 2014. As of August 2024, has been found a total of three times on iNaturalist, twice in Indiana and once in Nebraska.
Hesler's Lute grows on soil and decayed wood and can be found spring through late summer. It is a small, agaric with distant, notched, gray-colored gills. Not much is known about this mushroom due to its rarity.
Observations
August 16th, 2023 Indian Cave State Park

318
Growing alone on downed ash tree (well decayed) in open (but well shaded) mixed oak/hickory woodland. North facing slope.
- Smell: fant
- Cap: convex to flattening
- Stipe: strong, flexible, fibrillose
- Lamellae: notched
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATAAACTTGGTCAAGTTGTTGCTGGTCTTTAGAGACATGTGCACACTTGGCTTTTGTTTTCAAACCACCTTGTGCACCTTTTTGTGAACTTGAAGGACAAGGAATGCCCGTCATTGACCGATTTTTCCTCTTCAGTTCATGTTCTTACACATAATCAATTTGAAATATAATGGAATGTGATCTGGGACATTTCAATGCCCAATAAAATATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATGAAATTCTCAATCCCTTTAAATTTCTTGTTGAGGGGAATTTGGATGATGGAAGTTTGCAGGCTTCTTCTTCAAGTCTGCTCTTCTTAAATGCATTAGCAAGGATTTTTAATTTTGAAACCTTGGTCTGATAATTTATCTATGTCCAATGGTTTTAAATCAGTTGTCCTGCTTGGAAAGATTTATTTTGATTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Callistosporium hesleri (H.E. Bigelow) Vizzini, Matheny, Consiglio & M. Marchetti, Fungal Diversity 101: 235 (2020) [MB#831400]
Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved January 17, 2025, from Agaric.us website: https://agaric.us/common_names/names.html
Created February 26, 2026 at 8:43 PM



