Hesler's Lute (Callistosporium hesleri)
Hesler's Lute (Callistosporium hesleri)
Hesler's Lute (Callistosporium hesleri)
Hesler's Lute (Callistosporium hesleri)
Hesler's Lute (Callistosporium hesleri)
< Back to Home

Hesler's Lute

Callistosporium hesleri

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Callistosporiaceae > Callistosporium


Description

Hesler's Lute (Callistosporium hesleri) is an exceptionally rare mushroom. It was first collected and described in 1983, and wasn't found again until a soil DNA study found the mycelium in a Pine plantation in South Carolina in 2014. As of August 2024, has been found a total of three times on iNaturalist, twice in Indiana and once in Nebraska.

Hesler's Lute grows on soil and decayed wood and can be found spring through late summer. It is a small, agaric with distant, notched, gray-colored gills. Not much is known about this mushroom due to its rarity.


Observations

August 16th, 2023 Indian Cave State Park
 (Callistosporium hesleri)

318

Growing alone on downed ash tree (well decayed) in open (but well shaded) mixed oak/hickory woodland. North facing slope.

  • Smell: fant
  • Cap: convex to flattening
  • Stipe: strong, flexible, fibrillose
  • Lamellae: notched
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATAAACTTGGTCAAGTTGTTGCTGGTCTTTAGAGACATGTGCACACTTGGCTTTTGTTTTCAAACCACCTTGTGCACCTTTTTGTGAACTTGAAGGACAAGGAATGCCCGTCATTGACCGATTTTTCCTCTTCAGTTCATGTTCTTACACATAATCAATTTGAAATATAATGGAATGTGATCTGGGACATTTCAATGCCCAATAAAATATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATTTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATGAAATTCTCAATCCCTTTAAATTTCTTGTTGAGGGGAATTTGGATGATGGAAGTTTGCAGGCTTCTTCTTCAAGTCTGCTCTTCTTAAATGCATTAGCAAGGATTTTTAATTTTGAAACCTTGGTCTGATAATTTATCTATGTCCAATGGTTTTAAATCAGTTGTCCTGCTTGGAAAGATTTATTTTGATTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Callistosporium hesleri (H.E. Bigelow) Vizzini, Matheny, Consiglio & M. Marchetti, Fungal Diversity 101: 235 (2020) [MB#831400]

Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved January 17, 2025, from Agaric.us website: https://agaric.us/common_names/names.html


Created February 21, 2026 at 10:41 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.