Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
Icing Sugar Fungus (Beauveria bassiana)
< Back to Home

Icing Sugar Fungus

Beauveria bassiana

Life > Fungi > Ascomycota > Pezizomycotina > Sordariomycetes > Hypocreomycetidae > Hypocreales > Cordycipitaceae > Beauveria


Description

The Icing Sugar Fungus (Beauveria bassiana) is a widespread insect pathogen that can be found year-round infecting various species of hosts. The fungi erupt out of the joints of the insect exoskeleton as a white, powdery mass full of reproductive spores. This species infects a wide range of arthropod species. It has been used as a natural insecticide to combat a wide range of insects.

In many Ascomycetes, species can have multiple life stages. A stage where they make asexual spores via mitosis (anamorphic phase) and a life stage where they make sexual spores via meiosis (teleomorphic phase). Beauveria species are an anamorph for matching Cordyceps teleomorph. Past mycological convention was to separate these two forms into different species (like Beauveria and Cordyceps), and modern convention is to group them into one species. In the future, we may see the genus Beauveria disappear in favor of their respective teleomorphic Cordyceps species.


Observations

September 11th, 2023 Indian Cave State Park
Icing Sugar Fungus (Beauveria bassiana)

#369

  • Growing on winged insect on rotting hardwood log suspended above small creek in low oak/hickory woodland area.

Any leads on insect ID would be appreciated

DNA Barcode ITS:
GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.