Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
Eastern Tangerine Athena (Atheniella leptophylla)
< Back to Home

Eastern Tangerine Athena

Atheniella leptophylla

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Marasmiineae > Marasmiaceae > Atheniella


Description

The Eastern Tangerine Athena (Atheniella leptophylla) is a decomposer of duff and wood, and can be found in September in woodland areas. It is small, grows alone or in small groups, and has a Mycenoid stature, sharing features with the genus Mycena.

Cap: convex or bell-shaped, and sometimes papillate (with a nipple-shaped umbo). The surface is smooth and presents a striped pattern when moist from the gills underneath (translucent-striate). It is pale reddish-yellow, brighter toward the center (disc), and becomes pleated at the margin with age.

Gills: close, narrow, and attached to the stem with a decurrent tooth (uncinate), yellowish to whitish in color.

Stem: slender, hollow, smooth at the apex and center with coarse fibrils towards the base.

Spore Print: white.

Etymology: leptophylla comes from the Greek roots lepto- meaning "slender" and -phylla meaning "leaf" or "gill," referring to its thin gills.


Observations

October 23rd, 2023 Indian Cave State Park
 (Atheniella leptophylla)

479

Observed At: Tuesday, October 24, 2023 2:27 PM Created At: Tuesday, October 24, 2023 2:27 PM Last Modified At: Tuesday, October 24, 2023 2:34 PM Location: 40.26438530470901 -95.55880977653159 Form Group: Form Group: agaric Substrate: Substrate: terrestrial, humicolous Growth Habit: Growth Habit: caespitose Habitat: Same as prior Cap: Pileus: ( Shape: ( Profile: umbo to mammillate; papillate ); Surface: ( color: cream to buff-yellow to yellowish brown [1] ); Margin: ( Features: striate; plicate ) ) Shape: Shape: ( Profile: umbo to mammillate; papillate ) Surface: Surface: ( color: cream to buff-yellow to yellowish brown [2] ) Margin: Margin: ( Features: striate; plicate ) Gills: Lamellae: ( Attachment: uncinate ) Stem: Stipe: ( shape: terete to equal ) Footnotes: [1] Cap from center to margin: yellowish brown, buff yellow, to cream. [2] Cap from center to margin: yellowish brown, buff yellow, to cream.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAATTTCTGGAGTGTTGTCGCTGGCTTTTCGGAGCATGTGCACGCACTTCAAATTCTTCTCAACCACCTGTGCACTTTTGTAGACTATGATAACTCTCAATGATTTTATTATCTATTGGATTGAAGGACTTGCGTTTCAGCTGGTCTCTTCAACTTCATAGTCTACGTCTTATCTATAAACAAAGTCTTAGAATGTCTTTAATGGGTCTTTTTGACCTATAAAAACTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTTATTGACTTTATTGACAATGAGGCTTTGGATGTGGGAGTTTGCCGGCTTCTAACGAAGTCAGCTCTCCTTAAATACATTAGTGGTTACTGTTCCCCACTATATGGTGTGATAATTATCTACGCCTTGGTGGGGTTGTTAAGTGTAGCTGCTCTCTAACTGTCTCTCTTTCGAGACAACTTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Gminder, A. 2016. Nomenclatural novelties. Index Fungorum. 302:1-1 http://www.indexfungorum.org/Publications/Index%20Fungorum%20no.302.pdf

Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved October 14, 2025, from Agaric.us website: https://agaric.us/common_names/names.html

Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved October 14, 2025, from Agaric.us website: https://agaric.us/common_names/names.html

Peck, C.H. 1872. Report of the Botanist (1870). Annual Report on the New York State Museum of Natural History. 24:41-108 https://www.mykoweb.com/systematics/literature/Report%20of%20the%20State%20Botanist%201870.pdf

Redhead, SA. 2012. Nomenclatural novelties. Index Fungorum. 14:1-1 http://www.indexfungorum.org/Publications/Index%20Fungorum%20no.14.pdf


Created October 14, 2025 at 9:00 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.