Garlic-Odored Death Cap
Amanita suballiacea
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Phalloidae
Description
The Garlic-Odored Death Cap is a white to cream spore-colored mycorrhizal mushroom that associates mostly with Oak and Pine trees east of the Rocky Mountains. This species is considered deadly poisonous.
It has free, white gills. The stem has a ring (annulus) near the top and a sack-like cup (volva) at the base.
Observations
August 2nd, 2023 Indian Cave State Park

#276
- Growing solitarily on open mixed oak/hickory woodland ridge.
- Nearby Trees: American Hophornbeam, Black Oak, June Berry, Ash, Bur Oak, and Shagbark Hickory.
- Cap large (14-15cm), white, slightly tacky with a faintly striated margin.
- Lamellae white, crowded with frequent short gills, slightly serrated and not attached to stipe.
- Stipe white, with prominent annulus and enlarged white sack-like volva at the base, hollow or with central pith, and with upward recurved fibers most prominent midway up.
- Smell: not distinctive.
- Taste: faintly bitter sensation, but more or less not distinctive.
- KOH: lightly yellow on pileipellis and yellowish on stipe.
- Spore Print: white
- Microscopy: mounted in methylene blue. Basidia with 4 sterigmata.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGATGAACCTTGAGGCTGTAGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCGGTCTCTTGAGAAGTTGAAATCTAGGTGTCTATGCCATTTTATTAAACACTAGTTGCATGTTTATAGAATGATGATTTGATTATATATAAAGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCAAGGAGCATGCCTGTTTGAGTGTCATTAAAGTCTCAAGACCTGTCTGATTTTGATAGGTATTGGATTTTGGGGGTTGCAGGCTTTTTCAGATAGCCTGCTCTCCTTGAATGTATTAGTGGAGAAAGAGCCATTTGAACTCCATTGGTGTGATAAAACCTATCAATGCCAGGAGCAATGTTAGTTTTCTTGCTGTCTAACTGTCTGTAAAAATGGACAATTTGACCAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Amanita suballiacea (Murrill) Murrill, Mycologia 33: 448 (1941) [MB#284076]
Tulloss RE. 2024. Amanita suballiacea. in Tulloss RE, Yang ZL, eds. Amanitaceae studies. [ http://www.amanitaceae.org?Amanita+suballiacea ]. accessed August 15, 2024.
Created September 12, 2026 at 1:16 PM














