Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
Garlic-Odored Death Cap (Amanita suballiacea)
< Back to Home

Garlic-Odored Death Cap

Amanita suballiacea

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Phalloidae


Description

The Garlic-Odored Death Cap is a white to cream spore-colored mycorrhizal mushroom that associates mostly with Oak and Pine trees east of the Rocky Mountains. This species is considered deadly poisonous.

It has free, white gills. The stem has a ring (annulus) near the top and a sack-like cup (volva) at the base.


Observations

August 2nd, 2023 Indian Cave State Park
Garlic-odored Death Cap (Amanita suballiacea)

#276

  • Growing solitarily on open mixed oak/hickory woodland ridge.
  • Nearby Trees: American Hophornbeam, Black Oak, June Berry, Ash, Bur Oak, and Shagbark Hickory.
  • Cap large (14-15cm), white, slightly tacky with a faintly striated margin.
  • Lamellae white, crowded with frequent short gills, slightly serrated and not attached to stipe.
  • Stipe white, with prominent annulus and enlarged white sack-like volva at the base, hollow or with central pith, and with upward recurved fibers most prominent midway up.
  • Smell: not distinctive.
  • Taste: faintly bitter sensation, but more or less not distinctive.
  • KOH: lightly yellow on pileipellis and yellowish on stipe.
  • Spore Print: white
  • Microscopy: mounted in methylene blue. Basidia with 4 sterigmata.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAGATGAACCTTGAGGCTGTAGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCGGTCTCTTGAGAAGTTGAAATCTAGGTGTCTATGCCATTTTATTAAACACTAGTTGCATGTTTATAGAATGATGATTTGATTATATATAAAGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCAAGGAGCATGCCTGTTTGAGTGTCATTAAAGTCTCAAGACCTGTCTGATTTTGATAGGTATTGGATTTTGGGGGTTGCAGGCTTTTTCAGATAGCCTGCTCTCCTTGAATGTATTAGTGGAGAAAGAGCCATTTGAACTCCATTGGTGTGATAAAACCTATCAATGCCAGGAGCAATGTTAGTTTTCTTGCTGTCTAACTGTCTGTAAAAATGGACAATTTGACCAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Amanita suballiacea (Murrill) Murrill, Mycologia 33: 448 (1941) [MB#284076]

Tulloss RE. 2024. Amanita suballiacea. in Tulloss RE, Yang ZL, eds. Amanitaceae studies. [ http://www.amanitaceae.org?Amanita+suballiacea ]. accessed August 15, 2024.


Created August 25, 2025 at 9:43 AM and last updated August 25, 2025 at 9:43 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025