undefined (Amanita sp-NE01)
undefined (Amanita sp-NE01)
undefined (Amanita sp-NE01)
undefined (Amanita sp-NE01)
undefined (Amanita sp-NE01)
undefined (Amanita sp-NE01)
< Back to Home

Amanita sp-NE01

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Vaginatae


Description

Amanita sp-NE01 is a mycorrhizal mushroom that can be found in the summer in woodland settings. This one was found growing from a moss pad in an Oak/Hickory forest at Indian Cave State Park in eastern Nebraska.

The cap is colored light tan. The pattern on the cap are lines (striations) that go from the cap margin to 1/2 to the center of the cap. The gills are free from the stem to narrowly attached to it (acutely adnexed). The stem does not have a ring (annulus) and it has a cup at the base (volva). The volva looks like a sheath or a loose membranous sock on the base of the stem.


Observations

June 13th, 2023 Indian Cave State Park
Amanita Sect. Vaginatae (Amanita sp-NE01)

106

Growing from moss pad on open east-facing mixed oak/hickory woodland slope near Northern Red Oak, Shagbark Hickory, Ash, and Bur Oak.

  • Sheathing volva.
  • No annulus present.
  • Taste mild to nutty; pleasant.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAAACTTCTGGCTGGATGTTGTTGTGCTGGCCCTTTTGGGGGCAATGTGCACACCTCTGGCCATTTGTTTCTTCTGTTCCACCTGTGCACTGCCTGTAGACATTCTGTGTCTATGATACGCACACACACACACATACAGATGGTTAGGCATATATACTATATATAAAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACACAGCGAAATGTGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGCATTCCAAGGAGCATGCCTGTTTGAGTGTCGTTAAACTATCAAAACACTTTTCTTGGGTGTTTTGGACTTTGGGAGTGTCTTGCTGGTCTGTTTCAGCCAGCTCTCCTCAAAAGCATTAGCTTTGAAGACCATCAGTGTGATAATTTGTTTACACTGACTTGAGTGTCTCAGCTTCTCCTTTAAAATATCCTACCCCCTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.