Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
Murrill's Slender Caesar (Amanita murrilliana)
< Back to Home

Murrill's Slender Caesar

Amanita murrilliana

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Caesareae


Description

This is a mycorrhizal mushroom that grows in soil and can be found in the summer and fall east of the Rocky Mountains. It has a ring (annulus) on the upper side of the stem and a sack-like cup (volva) at the base. It can be found associating with Oak and other broadleaf trees.


Observations

July 25th, 2023 Indian Cave State Park
Murrill's Slender Caesar (Amanita murrilliana)

#243

  • Growing solitarily in lawn near mixed oak/hickory woodland edge.
  • Nearby Trees: Bur Oak, Elm, distant Black Walnut and Ash.
  • Cap light tan, becoming slightly darker towards the center, with a lined margin. No evidence of universal veil on pileipellis.
  • Stipe with prominent partial veil, slightly peeling in places (more prevalent near volva), hollow or with central pith.
  • Volva sack-like and delicate, not appearing to be swollen.
  • Smell: not distinctive.
  • Taste: not distinctive.
  • KOH: pale orange on pileipellis and stipe.
DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGGAATTGAAATTTCTGGCAGGAAGTTGTTGCTGGCTCCCCTTAGAAAAGGGAGTATGTGCACGCCTCTTGTTAGTTTCTTCCTTTCTCTCACCTGTGCACTGCCTGTAGACTTTTAAGTGTCTATGATATTTTTTTATTACACACACACACACACATACACTTTTGAATGTATTGTATTGGGTCAAGGTCATTTTGTACCTTATAATATTGCACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATCTATCAAAATACTTCATATTAGTGTTTTGGACATTGGGAATTATTGCTGGCCTTGGTATGTCAGCTTTCCTTAAAAATATCGAGTTTTCAAAGCCCTTCTCTGCTCATTGGTGTGATAAATATTATCTATGCCAAGGAAGCAAAGGCTTTCAGCCATGTTGACAAATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Amanita murrilliana Singer, Lilloa 22: 385 (1951) [MB#292455]

Kuo, M. (2013, June). The genus Amanita. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/amanita.html

Tulloss RE. 2024. Amanita murrilliana. in Tulloss RE, Yang ZL, eds. Amanitaceae studies. [ http://www.amanitaceae.org?Amanita+murrilliana ]. accessed August 15, 2024.


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.