Murrill's Slender Caesar
Amanita murrilliana
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Caesareae
Description
This is a mycorrhizal mushroom that grows in soil and can be found in the summer and fall east of the Rocky Mountains. It has a ring (annulus) on the upper side of the stem and a sack-like cup (volva) at the base. It can be found associating with Oak and other broadleaf trees.
Observations
July 25th, 2023 Indian Cave State Park

#243
- Growing solitarily in lawn near mixed oak/hickory woodland edge.
- Nearby Trees: Bur Oak, Elm, distant Black Walnut and Ash.
- Cap light tan, becoming slightly darker towards the center, with a lined margin. No evidence of universal veil on pileipellis.
- Stipe with prominent partial veil, slightly peeling in places (more prevalent near volva), hollow or with central pith.
- Volva sack-like and delicate, not appearing to be swollen.
- Smell: not distinctive.
- Taste: not distinctive.
- KOH: pale orange on pileipellis and stipe.
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGGAATTGAAATTTCTGGCAGGAAGTTGTTGCTGGCTCCCCTTAGAAAAGGGAGTATGTGCACGCCTCTTGTTAGTTTCTTCCTTTCTCTCACCTGTGCACTGCCTGTAGACTTTTAAGTGTCTATGATATTTTTTTATTACACACACACACACACATACACTTTTGAATGTATTGTATTGGGTCAAGGTCATTTTGTACCTTATAATATTGCACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATCTATCAAAATACTTCATATTAGTGTTTTGGACATTGGGAATTATTGCTGGCCTTGGTATGTCAGCTTTCCTTAAAAATATCGAGTTTTCAAAGCCCTTCTCTGCTCATTGGTGTGATAAATATTATCTATGCCAAGGAAGCAAAGGCTTTCAGCCATGTTGACAAATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGView MycoMap DNA Results
References
Amanita murrilliana Singer, Lilloa 22: 385 (1951) [MB#292455]
Kuo, M. (2013, June). The genus Amanita. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/amanita.html
Tulloss RE. 2024. Amanita murrilliana. in Tulloss RE, Yang ZL, eds. Amanitaceae studies. [ http://www.amanitaceae.org?Amanita+murrilliana ]. accessed August 15, 2024.
Created September 25, 2025 at 4:19 PM and last updated September 25, 2025 at 4:19 PM