White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
White Panther (Amanita multisquamosa)
< Back to Home

White Panther

Amanita multisquamosa

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanita.Subgenus > Amanita.Section > Pantherinae.Subsection


Description

The White Panther (Amanita multisquamosa) is a presumed toxic, mycorrhizal mushroom that fruits in the summer in woodland settings. These have been observed in Indian Cave State Park in eastern Nebraska in an Oak/Hickory woodland.

The fruiting body is mostly white, with a yellow or tan cap center. The cap is adorned with white, removable warts. The gill attachment is free to nearly attached (acutely adnexed), and the gill spacing is crowded. This species usually features a skirt of tissue on the stem (annulus), but sometimes the skirt falls off and/or is eaten by bugs. It has a bulbous base with a collar-like cup (volva) and sometimes transient velar tissue extending further up the stem.


Observations

June 12th, 2023 Indian Cave State Park
Small Funnel-veil Amanita (Amanita multisquamosa)

86

Growing on thin ridge top prairie remnants near bur oak, shagbark hickory, Chinkapin oak, and distant black oak in oak/hickory woodland. Tastes non distinctive. Pileipellis tacky when young/fresh.


Observation by thefungiproject
June 8th, 2023 Indian Cave State Park
Small Funnel-veil Amanita (Amanita multisquamosa)

#76

Growing in open mixed oak/hickory woodland.

  • Nearby Trees: Chinkapin oak, American Hophornbeam, American Linden, Shagbark Hickory, Elm, Red Mulberry, Bur Oak, and Black Oak.
  • Pileipellis tacky with removable veil remnants. Stipe slightly collapsible (hollow or with pith).

Observation by thefungiproject
July 11th, 2023 Indian Cave State Park
Small Funnel-veil Amanita (Amanita multisquamosa)

#184

  • Growing solitarily in open mixed oak/hickory woodland.
  • Nearby Trees: Eastern Red Cedar, American Hophornbeam, Northern Red Oak, Ash, American Linden, and Shagbark Hickory.
  • Cap adorned with removable warts.
  • Lammellae serrated.
  • No annulus present (potentially removed).
  • Volva with concentric scaly rings.

Smell: not distinctive. Taste: not distinctive. KOH: negative on cap.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAAAAAACTCAGGCAGGGGGGGAGTGTGGTTGTAGCTGGCCCCCTAATAAGGGCATGTGCACACTGTCTCTTTCTCTTGTTTGTTTTTTTCATTCTTTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCATTGTTCGGGTTGTCTATGATTTTCTTTTACATACATGAATCATTGTTGTACAGAATGTGATAAAAATGAATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTGTCAAAACATGCACTTGAGTGTGTTTTGGATTGTGGGAGTGTCTGCTGGCTTTATATGAGTCAGCTCTCCTGAAAGACATTAGCTTTGGAGGGATGTGCCAAGTCACTTCTGCCTTTCCATTGGTGTGATAGATGAATAAACTTATCTACGCCAGGAAAGCAGGTTGCAGGTGATGCACTGTGATCTCTCTGCTCTCTAATTGACATTTGTCTGATAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject
May 30th, 2024 Indian Cave State Park
Small Funnel-veil Amanita (Amanita multisquamosa)

661

  • Growing solitarily in well shaded mixed oak/hickory woodland, near walking trail.
  • Nearby Trees: American Hophornbeam, American Linden, Northern Red Oak, Shagbark Hickory, Ash, Chinkapin Oak.

Observation by thefungiproject

References

Kuo, M. (2013, April). Amanita multisquamosa. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/amanita_multisquamosa.html


Created September 20, 2026 at 1:53 PM