American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
American Blusher (Amanita amerirubescens)
< Back to Home

American Blusher

Amanita amerirubescens

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Pluteineae > Amanitaceae > Amanita > Amanitina > Validae


Description

The American Blusher (Amanita amerirubescens) is a mycorrhizal mushroom that can be found in Oak and Pine-dominated woods mostly during the summer but also into early fall. It is a gilled mushroom that can be found in the soil, has large membranous skirt, and has a bulbous base without a volva. It stains red and has a white spore print.

This species hasn't been described formally in North America yet, and is under the provisional name Amanita "rubescens-02".


Observations

June 2nd, 2024 Indian Cave State Park
Amanita Amerirubescens Group (Amanita amerirubescens)

666

  • Growing from soil in mixed oak/hickory woodland.
  • Nearby Trees: Eastern Red Cedar, Black Walnut, Eastern Cottonwood, Ash, Black Oak, Eastern Red Bud, White Mulberry, and American Hophornbeam.
  • Spore Print: white

Observation by thefungiproject
July 23rd, 2023 Indian Cave State Park
Amanita Amerirubescens Group (Amanita amerirubescens)

#223

  • Growing solitarily in open mixed oak/hikcory woodland, near edge.
  • Nearby Trees: Black Oak, Bur Oak, Eastern Red Cedar, American Hackberry, Ash and Black Walnut.
  • Cap tan with reddish hues, also adorned with tan universal veil remnants (easily removeable).
  • Lamellae white and crowded, staining red.
  • Margin staining red (lightly).
  • Stipe thick, with prominent annulus, bruising reddish from top 1/4 down to base.
  • Volva tan concentric bands on a swollen base, with white basal mycelium.

Smell: not distinctive. Taste: pleasant, almost nutty.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACGAAATGGGTGGCAAGGCTGTCGCTGGCTCTAATGAGCATGTGCACGCCTTTTGCTGCTTGCTTCATTCTCTTTTCCACCTGTGCACTCTTTGTAGACACTCGGGATGGGGAGAGAGTTGGCATCGAATGTTGGCCTCTCTTGATATTAAAAAGTCTGGGGTGTCTATGTGTTTTTTCACATACACAATTTGAATGTCTATAGAATGAAATTGTAGGCTTTTGTCAGCCTTTTAAATGATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAAACTTGTGCTTTTTTGGCATGGGATTTTTGGACATTGGGAGTTGCCGGCTGCTGATAAAGTGGTGGGCTCTTCTGAAAAGCATTAGTTGAGGAGCTTTGCACTCTATTGGTGTGATAGACTATCTATGCCAGGAGATGCTTCATGATCCTCTGCTGTCTAACTGTCTTTATCAGACAATATGTGATAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Tulloss RE. 2024. Amanita amerirubescens. in Tulloss RE, Yang ZL, eds. Amanitaceae studies. [ http://www.amanitaceae.org?Amanita+amerirubescens ]. accessed August 13, 2024.


Created June 26, 2025 at 10:30 AM and last updated June 26, 2025 at 10:30 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025