Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
Wrinkled Fieldcap (Agrocybe rivulosa)
< Back to Home

Wrinkled Fieldcap

Agrocybe rivulosa

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Strophariaceae > Agrocybe


Description

The Wrinkled Fieldcap (Agrocybe rivulosa) is a brown-spored, gilled decomposer that grows in soil in woodland settings.

It has a wrinkled cap top surface that is mostly white becoming tan towards the center. The stem is relatively long, has a ring (annulus), and has an abrupt bulb at the base with white "roots" (pseudorhizomorphs). The gills are slightly attached to the stem and begin light-colored and turn more brown with maturity.


Observations

July 26th, 2023 Indian Cave State Park
Wrinkled Fieldcap (Agrocybe rivulosa)

258

  • Growing solitarily in the bank of spring fed creek in mixed oak/hickory woodland.
  • Cap flat, white with a yellow central umbo surrounded by a radial wrinkled zone.
  • Lamellae, pale pink, adnexed, with frequent partial gills.
  • Stipe long, fibrulose with an anulus and bulbous base with white rhizomorphs.

Additional Info

  • Smell: fruity to anise-like.
DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATAAACTGACGACGGTTGAGCTGGCACCGCAGGTGCTCGCCGTCTGTCTATTTATCTCTTCTCCTCCTGTGCACCCCTTTGTAGATAGCTCGTAGACGGGAAACTGTCGAAAGGCTTTCTATGTTACTCTCATTCACTCAAGTATGTAACCAGAATGTAATCAATGGGCCTTTGTGCCTATAAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCCATCAGCTTTATTGCTTGCATGGTGGCTTGGATGTGGGGGTTTCTTGCTGGCTTTCATTAGTCTGCTCCCCTGAAATGCATTAGCTGGCTGCCTCTTTGCCAACTACATTGGTGTGATAATTATCTACGCCGATTGGTATCGAGTTGCGCTGCTTCTAACCGTCGCAAGACAAACATACATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Agrocybe rivulosa Nauta, Persoonia 18 (2): 272 (2003) [MB#488330]

Kuo, M. (2021, December). Agrocybe and Cyclocybe. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/agrocybe.html


Created September 25, 2025 at 4:19 PM and last updated September 25, 2025 at 4:19 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.

Offline Guide | About | Contact | © Fungi Project 2025