Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
Flat-Top Champion (Agaricus placomyces)
< Back to Home

Flat-Top Champion

Agaricus placomyces

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Agaricus


Description

The Flat-Top Champion (Agaricus placomyces) is a decomposer that can be found in soil from summer through fall. It can be found in mixed woods. This species of Agaricus grow quite large and mature caps can be flat (plane) with a darker-colored center. The gills start pinkish colored and turn to dark brown with age. It has a brown spore print.


Observations

July 9th, 2023 Indian Cave State Park
Inky Mushroom (Agaricus placomyces)

#169

  • Growing gregariously (locally abundant) among woodland duff in well shaded oak woodland edge with dense understory of brush (Rough Leaf Dogwood, and Autumn Olive).
  • All exterior flesh, but hymenium, bruising yellow where handled. Bruises later turning dark brown, especially on stipe.
  • Gills free from stipe, crowded, and pink when young, turning dark brown at maturity.
  • Stipe collapsible, either hollow or with central pith.

Taste: Not distinctive Smell: Mild and unexplainable.

DNA Barcode ITS:
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCCAGATGGGTTGTAGCTGGCTCCTAGGAGCATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTGTTGGGTATGGAGGAAGTGGTCAGCCTTATCAGCTCTCGCTGGATATGAGGACTTGCAGTGTGGAAGCAGTGCTGTCCGCTACTTGGCCATGGAATCTGTTTCCCATCAGAGTCTATGTTGTTCATTATACCCTATAAACTGTTATTGAATGTTTTTACATGGGCTTCTATGCCTATGAAAATTGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGTGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCCTATACTTTGTTGTAAAGGAGGGCTTGGACTGTGGAGGCTTGCTGGCCGCTGAATGTGGTCAGCTCCTCTGAAATGCATTAGCAGAACTGCTTGCGATCTGCCACAAGTGTGATAAATTATCTACACTAGCGAGGGGATTGCTCTCTGTGTTCAGCTTCTAATCGTCTTCAGTGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
View MycoMap DNA Results
Observation by thefungiproject

References

Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved September 6, 2024, from Agaric.us website: https://agaric.us/common_names/names.html

Peck, C.H. 1878. Report of the Botanist (1875). Annual Report on the New York State Museum of Natural History. 29:29-82


Created March 17, 2026 at 9:26 PM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.