Flat-Top Champion
Agaricus placomyces
Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Agaricus
Description
The Flat-Top Champion (Agaricus placomyces) is a decomposer that can be found in soil from summer through fall. It can be found in mixed woods. This species of Agaricus grow quite large and mature caps can be flat (plane) with a darker-colored center. The gills start pinkish colored and turn to dark brown with age. It has a brown spore print.
Observations
July 9th, 2023 Indian Cave State Park

#169
- Growing gregariously (locally abundant) among woodland duff in well shaded oak woodland edge with dense understory of brush (Rough Leaf Dogwood, and Autumn Olive).
- All exterior flesh, but hymenium, bruising yellow where handled. Bruises later turning dark brown, especially on stipe.
- Gills free from stipe, crowded, and pink when young, turning dark brown at maturity.
- Stipe collapsible, either hollow or with central pith.
Taste: Not distinctive Smell: Mild and unexplainable.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCCAGATGGGTTGTAGCTGGCTCCTAGGAGCATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTGTTGGGTATGGAGGAAGTGGTCAGCCTTATCAGCTCTCGCTGGATATGAGGACTTGCAGTGTGGAAGCAGTGCTGTCCGCTACTTGGCCATGGAATCTGTTTCCCATCAGAGTCTATGTTGTTCATTATACCCTATAAACTGTTATTGAATGTTTTTACATGGGCTTCTATGCCTATGAAAATTGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGTGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCCTATACTTTGTTGTAAAGGAGGGCTTGGACTGTGGAGGCTTGCTGGCCGCTGAATGTGGTCAGCTCCTCTGAAATGCATTAGCAGAACTGCTTGCGATCTGCCACAAGTGTGATAAATTATCTACACTAGCGAGGGGATTGCTCTCTGTGTTCAGCTTCTAATCGTCTTCAGTGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTView MycoMap DNA Results
References
Kalichman, J. (2023). Names - Agaricus & Agaricales. Retrieved September 6, 2024, from Agaric.us website: https://agaric.us/common_names/names.html
Peck, C.H. 1878. Report of the Botanist (1875). Annual Report on the New York State Museum of Natural History. 29:29-82
Created March 21, 2025 at 1:16 PM and last updated March 21, 2025 at 1:16 PM