Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
Slinder-Stemmed Champion (Agaricus leptocaulis)
< Back to Home

Slinder-Stemmed Champion

Agaricus leptocaulis

Life > Fungi > Basidiomycota > Agaricomycotina > Agaricomycetes > Agaricomycetidae > Agaricales > Agaricineae > Agaricaceae > Agaricus


Description

The Slinder-Stemmed Champion (Agaricus leptocaulis) is a decomposer that can be found in soil in mixed woods from late summer to early fall. It has been reported in the Midwest to the East Coast. It can be found growing alone or in small groups. The cap and stem bruise yellow where handled.

Morphology

The cap shape is evenly rounded to broadly rounded, becoming flat with age. Sometimes with a slight umbo. Sometimes splitting radially at the margin. The cap texture is smooth and dry. The color is grayish-brown with brown scales that are more densely collected at the center than the margin.

The gills are free from the stem. The gill color is light pink when young, becoming darker pink, then becoming brown with age. This is due to brown spores maturing on the gill surface over time.

The stem features an elastic pendant-shaped skirt on the top half and a small bulb on the base. Sometimes curved. 1.5-4.5 inches long (3.5-11.5 cm) × 0.3-0.5 inches wide (8-14 mm).

The odor ranges from indistinct to pleasant to phenolic (like band-aids or glue). The spore print is brown.


Observations

August 8th, 2023 Indian Cave State Park
 (Agaricus leptocaulis)

283

Growing gregariously in open mixed oak/hickory woodland edge.

  • Cap overall whitish with brown center. Dark scales radiating from the center towards margin. Gill margin with sterile tissue.
  • Lamellae pink, crowded, frequent partial gills, and broadly free from the stipe.
  • stipe pinkish at apex, turning white below, fibrilose, with a prominent partial veil, and a swollen base that slowly bruises slightly yellow.
  • partial veil membranous, delicate, and with an eight entire margin with slight striations from gills.
  • Smell: faintly pleasant
  • Taste: mild and pleasant
  • KOH: highlighter yellow on pileipellis.

9/28/23: 2 additional specimens added to collection.

DNA Barcode ITS:
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCTAGATCGGTTGTAGCTGGCTCGTAGGAGCATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTGTTGGGTATGGAGGAAGTGGTCAGCCTTATCAGCTCTCGCTGGATATGAGGACTTGCAGTGTGAAAGCAGTGCTGTCCGCTACTTGGCCATGGAATCTGTTTCCCGTCAGAGTCTATGTTGTTCATTATACCCTATAAACTGTTATTGAATGTTTTTACATGGGCTTCTATGCCTATGAAAATTGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCCTATACTTTGTTGTAAAGGAGGGCTTGGACTGTGGGGGTTTGCTGGCCGCTTGCTGTGGTCAGCTCCTCTGAAATGCATTAGCAGAACTGTTTGCGATCTGCCACAAGTGTGATAAATTATCTACACTGGCGAGGGGATTGCTCTCTGTGTTCAGCTTCTAATCGTCTTCAGTGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
View MycoMap DNA Results
Observation by thefungiproject

References

Kerrigan, RW. 2016. Agaricus of North America. Memoirs of the New York Botanical Garden. 114:1-570

Kuo, M. (2018, January). Agaricus leptocaulis. Retrieved from the MushroomExpert.Com Web site: http://www.mushroomexpert.com/agaricus_leptocaulis.html


Created August 10, 2026 at 10:51 AM

Nebraska Mushrooms is a collaboration of wildlife groups with a mission to promote the education, recreation, and conservation of fungi in Nebraska.